Une étude clinique et épidémiologique de la première infection humaine rapportée avec le parasite zoonotique Trypanosoma evansi en Asie du Sud-Est

Contexte Le trypanosome est un genre de protozoaires flagellés parasitaires unicellulaires, Trypanosoma brucei et Trypanosoma cruzi sont les principaux agents de la trypanosomose humaine; Les autres espèces de Trypanosoma peuvent causer des maladies humaines, mais elles sont rares En mars, une femme âgée s’est présentée dans un établissement de santé du sud du Vietnam avec de la fièvre, des maux de tête et des arthralgies. Examen microscopique du sang a révélé une infection par TrypanosomaMethods Des tests sérologiques ont été effectués pour identifier les espèces infectantes. Le sang du patient a été analysé pour détecter la protéine trypanocide apolipoprotéine L APOL, et une étude de terrain a été réalisée pour identifier la source zoonotique. L’amplification PCR et les tests sérologiques ont identifié les espèces infectantes comme Trypanosoma evansi Malgré des semaines de récidives après la fin de l’amphotéricine B, le patient a complètement récupéré après des semaines de suramine. Le patient présentait des allèles APOL de type sauvage et une concentration sérique normale en APOL Après un échantillonnage d’animaux sensibles dans le lieu présumé d’exposition, / ou buffle nous Nous rapportons le premier cas de T evansi confirmé en laboratoire chez un individu précédemment en bonne santé sans déficit en APOL, potentiellement contracté par une plaie. Une étude épidémiologique liée à la suramine a révélé que la charge de T evansi était répandue et non identifiée chez les bovins locaux, ce qui souligne la nécessité de surveiller cette infection chez les animaux et la possibilité de nouveaux cas humains.

Vietnam, zoonose, Trypanosoma evansi, étude de cas, infections émergentesL’Asie du Sud-Est est un point chaud pour les maladies infectieuses émergentes et réémergentes Au cours de la dernière décennie, le Vietnam en particulier a été un épicentre de ces infections Le pays a une population humaine de & gt; millions, certaines des plus fortes densités de bétail d’élevage en Asie, et un fardeau important de maladies infectieuses, dont beaucoup se produisent sans diagnostic étiologique Plus de la moitié de la population vietnamienne réside dans les zones rurales, et la plupart participent à des Par conséquent, nous prévoyons que les infections zoonotiques surviennent fréquemment dans les régions rurales, mais ne déclenchent pas la transmission interhumaine et échouent souvent à être diagnostiquées. La capacité diagnostique limitée dans les établissements de santé animale provinciaux, les enquêtes épidémiologiques concluantes sur les infections zoonotiques chez les animaux potentiels sont coûteuses, difficiles et rarement pratiquéesTrypanosoma est un genre de protozoaires flagellés parasitaires unicellulaires de la classe des Kinetoplastida Le genre a plusieurs membres, dont la majorité transmission entre différents hôtes pour compléter Les principaux parasites zoonotiques, les espèces de Trypanosoma brucei et les espèces de T. brucei et de T. brucei rhodesiense et Trypanosoma cruzi causent une charge substantielle de la maladie du sommeil et de la maladie de Chagas. en Afrique subsaharienne et en Amérique latine, d’autres espèces de Trypanosoma, telles que T lewisi, T brucei, sous-espèce brucei, T congolense et T evansi, peuvent également causer des maladies chez l’homme, mais sont rares La majorité de ces cas humains atypiques des infections à Trypanosoma sont dues à T lewisi et T evansi Trypanosoma lewisi est un parasite non pathogène omniprésent des rats, et est considéré comme un pathogène humain, bien qu’il n’y ait eu qu’un nombre limité de cas signalés Trypanosoma evansi est associé à des infections aiguës. la maladie chez les chameaux et les chevaux surra et les maladies chroniques chez les bovins et les buffles, et peut être trouvé en Amérique du Sud, Afrique du Nord, Moyen L’Asie de l’Est et du Sud et du Sud-Est Le seul cas humain de T evansi avec confirmation moléculaire de l’espèce infectante est survenu en Inde en Ce patient présentait une carence en apolipoprotéine L APOL , un composant du sérum humain à activité trypanocide [ ] Quatre autres cas probables ont été rapportés dans le monde , en Inde et en Egypte, mais aucune spéciation moléculaire parasitaire n’a été réalisée. Nous décrivons ici une investigation clinique, parasitologique et épidémiologique de la première infection humaine confirmée de T evansi chez un individu précédemment sain. sans déficit en APOL en Asie

RAPPORT DE CAS

En mars, une vietnamienne âgée d’un an s’est présentée dans un établissement de santé de la province de Dong Nai, au sud du Vietnam, à quelques kilomètres de Ho Chi Minh Ville. Elle n’a pas consulté un médecin pendant cette période. traitée avec des antipyrétiques Elle travaillait dans une usine de chaussures, avait accouché en novembre et allaitait un nourrisson en bonne santé. Son seul récit de voyage récent était au district de Krong Pac à Dak Lak, une province rurale dans les montagnes du centre du Vietnam, de février à mars, pour rendre visite à des parents pendant les vacances du Nouvel An lunaire. Le jour suivant, elle est restée fébrile et a été transférée à l’hôpital pour les maladies tropicales HTD à Ho Chi Minh-Ville. En admission à HTD, elle a eu un Le score de Glasgow Coma Scale était de: ° C, la fréquence respiratoire était de respiration / minute, le pouls battait / minute et la pression artérielle était de / mm Hg. L’examen cardiorespiratoire était normal et abdominal. l’examen a révélé une hépatomégalie non testéeLes tests sanguins initiaux ont montré une pancytopénie et une insuffisance rénale légère avec un foie surélevé. aminotransférases et hypoalbuminémie Tableau; les électrolytes, la lactate déshydrogénase, la créatine phosphokinase et la troponine I se situaient dans les limites normales. Cultures microbiologiques réalisées sur le sang, l’urine et le liquide céphalorachidien Le liquide céphalorachidien n’a pas produit de croissance significative; La numération des cellules du CSF, les protéines et le glucose étaient dans les limites normales. Les tests sérologiques pour l’hépatite B, l’hépatite C et le virus de l’immunodéficience humaine étaient négatifs. Un frottis sanguin, coloré au Giemsa et examiné au microscope, était négatif pour le paludisme; Cependant, de nombreux protozoaires flagellés unicellulaires, avec la morphologie distinctive de Trypanosoma et avec une concentration estimée de & gt; parasites / μL, ont été identifiés Figure Motif parasites ont également été observés par examen microscopique direct du sang Données supplémentaires Radiographie thoracique et l’électrocardiographie étaient normaux, et échographie abdominale confirmée hépatomégalie mm et splénomégalie mm

Tableau chronologique des investigations de laboratoire clinique et des résultats d’une infection humaine à Trypanosoma evansi-Vietnam, Test de la gamme normale Première admission Première décharge Deuxième admission Deuxième décharge Date de suivi … Mars Mars Mai Juin Juillet Nombre de cellules leucocytaires / μL – Nombre de neutrophiles, cellules / μL – Hémoglobine, g / dL – numération plaquettaire, × cellules / L – Procalcitonine, ng / mL & lt; ND ND ND Créatinine, mmol / L – Ferritine, ng / mL – ND ND Albumine, g / L – ND Bilirubine, μmol / L – ND AST, U / L – ALT, U / L – Test Plage normale Première Admission Première décharge Deuxième admission Deuxième sortie Date de suivi … Mars Mars Mai Juin Juillet Nombre de globules blancs, cellules / μL – nombre de neutrophiles, cellules / μL – hémoglobine, g / dL – numération plaquettaire, × cellules / L – Procalcitonine, ng / mL & lt; ND ND ND Créatinine, mmol / L – Ferritine, ng / mL – ND ND Albumine, g / L – ND Bilirubine, μmol / L – ND AST, U / L – ALT, U / L – Les valeurs en dehors de la plage normale sont affichées en grasAbbreviations: ALT, alanine aminotransférase; AST, aspartate aminotransférase; ND, non déterminé; WBC, globule blancView Large

Figure Vue largeTélécharger un échantillon de sang coloré par Giemsa montrant Trypanosoma evansi dans le sang d’une femme vietnamienne d’un an au grossissement × A et × B, avec des formes typiques du sous-genre Trypanozoon parasites longueur totale – μm, flagelle libre, noyau central, grand membrane ondulante, petits kinétoplastides subterminaux [& lt; μm], et une extrémité postérieure pointueFigure View largeTélécharger un échantillon de sang coloré par Giemsa montrant Trypanosoma evansi dans le sang d’une femme vietnamienne d’un an au grossissement × A et × B, avec des formes typiques du sous-genre Trypanozoon parasites longueur totale – μm, flagelle libre, noyau central, grande membrane ondulante, petites kinétoplastides subterminales [& lt; Par conséquent, la patiente a été traitée avec de l’amphotéricine B mg / kg / jour pendant plusieurs jours, en raison de son activité trypanocide . Elle était afébrile. Après les heures de traitement, les frottis sanguins ont montré une diminution de la parasitémie trypanosomienne des parasites / μL aux parasites / μL, respectivement. Aucun parasite n’a été observé dans les frottis sanguins au quatrième jour de traitement. Les numérations globulaires et plaquettaires se sont améliorées. l’hémoglobine a chuté à g / dL Elle a été libérée sans symptômes et avec des valeurs de sang normales le jour après l’admission. Tableau Le patient a été rappelé pour les semaines de suivi après la décharge; Elle est restée asymptomatique avec des valeurs sanguines normales, et aucun parasite n’était visible à la microscopieSix semaines après la sortie de l’hôpital Mai, le patient est revenu à HTD avec des jours de fièvre, maux de tête, nausées et vomissements. Une échographie a montré hépatomégalie de mm et splénomégalie de mm, et un frottis de sang périphérique identifié & gt; L’examen du parasite / μL était normal À ce moment, la suramine provenait de l’Organisation mondiale de la santé (OMS) et elle était traitée par g pendant des semaines. La fièvre disparaissait quelques heures après la première dose et le frottis était négatif en quelques heures. La patiente a été congédiée et a suivi un traitement de suramine sans complication. Elle a été suivie mensuellement pendant des mois avec des examens cliniques et des frottis sanguins. Des investigations supplémentaires pour identifier le parasite infectant, les réponses sérologiques et la sensibilité du patient ont été entreprises.

Méthodes

Identification des parasites et génotypage

L’identification du sous-genre des trypanosomes a été réalisée par morphologie et morphométrie sous examen microscopique du parasite à l’aide de frottis sanguins colorés au Giemsa Pour détecter l’ADN parasitaire dans les prélèvements sanguins, les amorces suivantes ont été utilisées pour l’amplification en chaîne par polymérase: Tryp générique pour les trypanosomes. NRP et TBR Trypanozoon sous-genre , EVA , TEPAN , TE / , RoTat F / R T evansi / T equiperdum spécifique, EVAB / T evansi type B spécifique, et Lew T L’ADN spécifique de l’espèce lewisi a été extrait à l’aide du QIAamp DNA Blood Mini Kit en suivant les recommandations du fabricant. Les amplifications PCR ont été réalisées en volumes de μL en utilisant les conditions d’amplification décrites dans les publications citées. L’ADN ribosomique de SSU S a été réalisé comme décrit précédemment De nouvelles séquences nucléotidiques du gène de l’ARN ribosomique partiel du SSU du Vietnamien T evansi ont été déposé dans GenBank sous les numéros d’accès suivants: KT, T evansi isoler T humain Vietnam première infection; KT, T evansi isoler T bovins Vietnam; KT, T evansi isoler T bovins Vietnam; et KT, T evansi isoler T rechute humaine Vietnam

Tests sérologiques

Le test d’agglutination sur carte T evansi CATT / T evansi Institut de Médecine Tropicale, Anvers, Belgique est destiné au sérodiagnostic de la trypanosomose animale causée par T evansi , et permet de détecter les anticorps anti-T evansi dans le sang, le sérum et le plasma. Les échantillons sériques positifs ont été testés dans des dilutions en série pour fournir une estimation semi-quantitative de l’anticorps anti-T evansi dans le sérum du patient. Un test immuno-enzymatique ELISA T evansi a été également réalisé en utilisant le premier échantillon de patient en tant que contrôle positif

Test APOL

L’ADN génomique total a été extrait à partir d’échantillons sanguins à l’aide du kit d’extraction d’ADN génomique Nucleon. La PCR GE Healthcare a été utilisée pour amplifier le gène APOL en utilisant les amorces F- ‘AGCCACCACACCGAGCCAAAACTGC et R – ‘AGCACAAGAAAGAAGCTTACAGGGG pour amplifier une région -bp d’APOL sur le chromosome q Des amplicons PCR ont été clonés dans pCRR Topo et séquencés dans les deux sens en utilisant le séquençage BigDye sur un séquenceur ABIXL Applied Biosystems Quantitative Sandwich ELISA USCN Life Sciences ont été réalisées en double selon le fabricant. instructions pour mesurer la concentration d’APOL dans le sérum du patient et le sérum de volontaires vietnamiens anonymes sains

Enquête de terrain

Nous avons effectué un recensement des élevages de bovins et de buffles situés dans un rayon d’un rayon de la famille du patient. De chaque animal prélevé, du sang a été prélevé par ponction auriculaire et de la veine jugulaire dans des tubes EDTA à l’acide éthylènediaminetétraacétique. et des frottis de sang minces qui ont été fixés et colorés en utilisant un revêtement Giemsa Buffy de tubes microcapillaires centrifugés et des frottis colorés au Giemsa ont été examinés à un grossissement x pour la présence de trypanosomes. Le sang EDTA de la veine jugulaire a été centrifugé et la couche leucocytaire et le plasma ont été séparés; le premier a été utilisé pour les tests moléculaires, le second pour les tests sérologiques. Les rats ont été piégés dans plusieurs des fermes échantillonnées et les échantillons sanguins ont été testés par sérologie et amplification PCR. Le personnel du sous-département de la santé animale et du l’échantillonnage des animaux Les tests sérologiques ont été réalisés en utilisant le CATT sur plasma de toutes les espèces; Les tests ELISA ont été réalisés uniquement sur des bovidés

Approbation éthique

Le consentement éclairé a été obtenu du patient impliqué dans cette investigation. La permission pour l’investigation sur le terrain a été couverte par les protocoles existants pour une étude en cours sur les infections zoonotiques au Vietnam VIZIONS , qui ont été approuvés par HTD et le Oxford Tropical Research Ethics Committee

RÉSULTATS

Réponse sérologique du patient, identification des trypanosomes et test APOL

Six échantillons de plasma provenant de la présentation primaire du patient, de la rechute et du suivi tardif ont donné des agglutinations positives en utilisant le test CATT / T evansi et étaient positifs à des dilutions sur la présentation primaire, la convalescence et la rechute, respectivement. Les échantillons de suivi post-traitement ont fourni des preuves de diminution des concentrations d’anticorps, tests positifs à:,: et: dilutions à, et mois après traitement, respectivement. Le sang total du patient a été soumis à amplification PCR pour confirmer l’infection. testé positif pour Trypanozoon et pour T evansi, et négatif pour T lewisi et T evansi Tableau B Il a été conclu que le patient était infecté par T evansi type A

Tableau Laboratoire Confirmation de l’infection à Trypanosoma evansi-Vietnam, Date Microscopie de l’échantillon CATT CATT Titration PCR Amplificationa Tryp EVA PNR TE / Rotat TEPAN Lew Mars Première admission: – Avril Suivi -: – – – – – – – Mai Deuxième admission: – Juin Suivi -: – – – – – – Juillet Suivi -: – – – – – – – Sept Suivi -: – – – – – – – Date Microscopie de l’échantillon CATT CATT Titrage PCR Amplificationa Tryp EVA NRP TE / Rotat TEPAN Lew Mars Première admission: – Avril Suivi -: – – – – – – – Mai Deuxième admission: – Juin Suivi -: – – – – – – Juillet Suivi -: – – – – – – – Sept Suivi -: – – – – – – – Abbreviati ons: CATT, test d’agglutination sur carte T evansi; PCR, réaction en chaîne de la polymérase Tryp générique pour les trypanosomes , NRP et TBR Trypanozoon sous-genre , EVA , TEPAN , TE / , RoTat F / R T evansi / T equiperdum spécifique, EVAB / [, ] T evansi type B spécifique, et Lew T lewisi spécifique à l’espèceView LargeLa concentration d’APOL dans le sérum du patient était de ng / mL; les concentrations d’APOL chez les volontaires sains vietnamiens allaient de ng / mL médiane, ng / mL [intervalle interquartile, – ng / mL] En outre, il a été confirmé que le patient avait des allèles APOL de type sauvage, c.-à-d. séquençage du gène codant pour APOL

Enquête de terrain

La patiente n’a signalé aucun contact direct avec des animaux dans la province de Dak Lak, mais elle a recueilli des buffles et des bovins dans la région. Elle ne se souvenait pas de morsures d’animaux ou d’insectes, mais Le nombre total de fermes de bovins et de buffles a été identifié dans un rayon de – km du domicile de la famille du patient à Krong Pac Ces fermes contenaient un total de poulets, de bétail, de bétail et de viande. buffles, cochons, chiens, chats et personnes Figure Sang prélevé sur des bovins et des buffles choisis au hasard A l’examen microscopique, des% d’échantillons de sang de bovins provenant de fermes différentes contenaient des espèces de Trypanosomes; les parasites n’ont pas été observés dans le sang des autres animaux

Figure Vue largeTélécharger la carte du site échantillonné dans la province de Dak Lak au centre du Vietnam A, carte du Vietnam avec les emplacements des provinces de Ho Chi Minh, Dong Nai et Dak Lak mis en évidence B, Carte des fermes échantillonnées en réponse au cas humain de Trypanosoma evansi Le cercle orange A indique l’emplacement de la maison du patient. Les emplacements de la ferme échantillonnés sont représentés et codés comme suit: blanc, aucune trace de trypanosomes; jaune, réaction en chaîne de la polymérase et / ou évidence sérologique de T evansi chez les bovins ou les buffles; rouge, évidence microscopique des espèces de Trypanosoma dans le sang de bovins ou de bufflesFigure Voir grandTélécharger la carte du site échantillonné dans la province de Dak Lak au centre du Vietnam A, Carte du Vietnam avec les localisations des provinces de Ho Chi Minh, Dong Nai et Dak Lak Carte des fermes échantillonnées en réponse au cas humain de Trypanosoma evansi Le cercle orange A montre l’emplacement de la maison du patient Les emplacements de la ferme échantillonnés sont montrés et codés comme suit: blanc, pas de traces de trypanosomes; jaune, réaction en chaîne de la polymérase et / ou évidence sérologique de T evansi chez les bovins ou les buffles; rouge, preuve microscopique des espèces de Trypanosoma dans le sang des bovins ou des bufflesL’amplification PCR pour les trypanosomes a été réalisée sur une matrice d’ADN extraite du sang des animaux échantillonnés Neuf de% et de% échantillons sanguins de bovins et buffles, respectivement, ont produit des amplicons PCR indicatifs de T evansi En outre, sur des échantillons de sang de bovins et de bufflons, des anticorps appréciables contre T evansi ont été détectés par CATT et / ou ELISA. En réponse à d’autres questions, les éleveurs de fermes échantillonnées, y compris toutes les fermes ayant des animaux confirmés en microscopie parasitémie signalait une maladie inexpliquée récente chez leurs bovins caractérisée par une atrophie, des membres paralysés et la mort, encore une fois indicative d’une infection à T evansi.Une comparaison entre quatre séquences d’ADN ribosomique produites à partir du sang du patient et du bétail présentait% d’homologie d’ADN. De plus PCR positif pour Rotat et négatif pour EVAB, ce qui suggère T evansi type Une infection à la fois chez le patient et chez les bovins échantillonnés

DISCUSSION

Nous présentons le premier cas rapporté d’infection humaine à T evansi en Asie du Sud-Est Trypanosoma evansi est un parasite zoonotique que l’on trouve couramment chez les bovins dans les régions tropicales, bien que la maladie humaine soit exceptionnellement rare. facteurs de l’infection à Trypanosoma Deux mutations dans le gène codant l’apolipoprotéine L APOL, dans les codons et ont été précédemment associées à la sensibilité de T evansi chez un patient indien. APOL est une composante omniprésente des lipoprotéines de haute densité présentes dans le plasma qui tue les trypanosomes par lysosome Les modèles animaux suggèrent qu’il pourrait y avoir d’autres facteurs de susceptibilité aux infections à Trypanosoma, y ​​compris l’augmentation de l’activité de l’arginase de l’hôte et la biodisponibilité de l’oxyde nitrique , réponses d’interféron de type I défectueuses, et d Le seul facteur de risque identifié était que le patient était – mois post-partum au moment de l’exposition, ce qui est un facteur de risque bien connu pour de nombreuses maladies infectieusesIl n’y a aucun rapport précédent décrivant le traitement de T evansi avec amphotéricine B et, bien que l’administration soit ici corrélée avec la défervescence et la clairance parasitaire, il est difficile de déterminer si le médicament ou une réponse immunologique naturelle a induit cette action d’un modèle murin de T cruzi suggérant que l’amphotéricine B pourrait avoir une action trypanostatique mais une faible activité trypanocide. Comme notre patient a rechuté des semaines plus tard, l’efficacité de l’amphotéricine B pour le traitement par T evansi demeure ambiguë. Le traitement à la suramine a cependant entraîné une guérison rapide et prolongée. La suramine est actuellement le traitement de première intention recommandé pour le T b rhodesiense précoce. été utilisé avec succès dans le traitement de l’homme T evansi précédemment Notre cas fournit des preuves supplémentaires pour su Efficacité du ramin contre ce parasite En outre, une diminution de la réponse anticorps a également été observée avec des titres CATT tombant de: au moment du traitement à: quatre mois après l’infection Cependant, ce titre CATT n’a pas augmenté en rechute, suggérant un manque d’immunoglobuline M sur la parasitémie secondaireL’enquête épidémiologique rapide accompagnant cette première infection humaine de T evansi en Asie du Sud-Est témoigne des systèmes coordonnés de santé publique et animale du Vietnam et des liens entre cliniciens et chercheurs. Le test rapide de & gt; des animaux d’espèces différentes dans différentes fermes dans un rayon de -km de la résidence du patient ont trouvé qu’une proportion substantielle de bovidés dans les fermes entourant la maison du patient avait une infection à T evansi confirmée par PCR% des bovidés avaient en plus des preuves sérologiques de l’infection. Les parasites détectés chez le patient infection primaire et rechute et les parasites identifiés chez les bovidés étaient T evansi type A Un séquençage supplémentaire du fragment polymorphe de l’ADNr SSU a démontré un haut degré d’homologie entre les parasites animaux et humains, impliquant les bovidés locaux comme les plus probables source de l’infection On sait que Trypanosoma evansi est endémique au Vietnam, et des séroprévalences proches de% ont été décrites chez des bovidés et des chevaux dans le delta du fleuve Rouge; Cependant, l’ampleur du problème en termes de distribution géographique et de prévalence chez les bovins / buffles au Vietnam est actuellement indéterminée et probablement sous-estimée. La mort inexpliquée de plusieurs bovins dans la localité du patient a été probablement due au surra comme indiqué par les signes cliniques et la prévalence de T evansi chez ces espèces; ces résultats impliquent également que le parasite circule sans être détecté depuis un certain temps. L’endémicité de T evansi peut avoir des conséquences économiques, mais elle met également en évidence le potentiel de nouveaux cas humains. La voie de transmission précise chez ce patient reste incertaine; cependant, l’inoculation directe par une blessure à la main, comme décrit précédemment en Inde , est l’explication la plus raisonnable. En conclusion, nous avons décrit le premier cas humain d’infection à T evansi en Asie chez un individu précédemment sain sans déficit en APOL. Des études de terrain ultérieures ont démontré une forte prévalence de bovidés dans les environs immédiats du patient avec des signes cliniques et moléculaires d’infection à T. evansi. L’infection a très probablement été contractée par inoculation directe de la viande de bovins infectés. Des recherches supplémentaires sont nécessaires pour mieux comprendre ce pathogène zoonotique. , y compris les facteurs de susceptibilité de l’hôte, les vecteurs potentiels et les options thérapeutiques pour les infections humaines et animales

Remarques

Remerciements Nous remercions le professeur Peter Chiodini de la London School of Hygiene and Tropical Medicine, qui a fourni des conseils cliniques sur le cas; et l’Organisation mondiale de la Santé, pour fournir rapidement de la suramine gratuitement. Le laboratoire BioZoonoSEA Kasetsart University a fourni tous les équipements et tests de diagnostic pour la caractérisation des trypanosomes. Nous approuvons en outre le Réseau sur les infections humaines atypiques par les trypanosomes animaux. et décrivez ce cas. umr-intertrypciradfr / content / download /// version // fichier / LeafletpdfAuthor contributions L’auteur correspondant avait un accès complet à toutes les données de l’étude et avait la responsabilité finale de la décision de soumettre à la publicationDisclaimer L’organisme de financement n’a joué aucun rôle participation à la conception, la mise en œuvre ou l’analyse de l’étude ou à la décision de publier les résultats. Soutien financier Ce travail a été soutenu par le prix stratégique Wellcome Trust of Great Britain WT / SB est un Fellow Sir Henry Dale, financé conjointement par le Wellcome Trust et les conflits d’intérêts Royal Society / Z // ZPotential Tous les auteurs: Aucun conflit signalé Tous les auteurs ont soumis le formulaire ICMJE pour la divulgation des conflits potentiels de conflits d’intérêts que les éditeurs jugent pertinents pour le contenu du manuscrit ont été divulgués